View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_131 (Length: 252)
Name: NF20665_low_131
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_131 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 114 - 252
Target Start/End: Original strand, 45090228 - 45090366
Alignment:
| Q |
114 |
tatgcaaataaaatttgattattttggcttggaatcttatgtggtgattatgatgtttaggaggctagaagctgatcgtttcttcacaacaaatttcaac |
213 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45090228 |
tatgaaaataaaatttgattattttggtttggaatcttatgtggtgattatgatgtttaggaggctagaagctgatcgtttcttcacaacaaatttcaac |
45090327 |
T |
 |
| Q |
214 |
tcaaaaacatacacaaaccaaggttttgaatgggtaaac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45090328 |
tcaaaaacatacacaaaccaaggttttgaatgggtaaac |
45090366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 45090133 - 45090216
Alignment:
| Q |
7 |
tgagatgaagataaaagggtttgctataagtgagactgctttctttatctttgtgatcatggcttcaaggtaagttttaagcac |
90 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45090133 |
tgagaagaagatcaaagggtttgctataagtgagactgctttctttatctttgtgatcatggcttcaaggtaagttttaagcac |
45090216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University