View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_133 (Length: 252)
Name: NF20665_low_133
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_133 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 45108590 - 45108349
Alignment:
| Q |
11 |
agaatatgaaaggtgtatatgtagataaatcaagacaccactatggctatatatggtgattgctaaggctaataacagttacagatattactattattat |
110 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108590 |
agaatatgaaaggtttatatatagataaatcaagacaccactatggctatatatggtgattgctaaggctaataacagttacagatattactattattat |
45108491 |
T |
|
| Q |
111 |
tggtgcgcctcacgtctaattactcggtatacttggcctcacagctaacaggatacaacaacggcttctcactaacatagcacatgaattatcaagggca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108490 |
tggtgcgcctcacgtctaattactcggtatacttggcctcacagctaacagaatacaacaacggcttctcactaacatagcacatgaattatcaagggca |
45108391 |
T |
|
| Q |
211 |
caaaccccataaaatatgctcacagccaaaccataggccgta |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108390 |
caaaccccataaaatatgctcacagccaaaccataggccgta |
45108349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University