View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_142 (Length: 250)
Name: NF20665_low_142
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_142 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 36094625 - 36094394
Alignment:
| Q |
1 |
ttcacacattaagcccaacagtgttgggcgcgggcgtatcgaaatgtgtaaatatatcgcactct--tttttcttcttacagttctagaagcaaatctat |
98 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||| ||||||| |||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
36094625 |
ttcacacattaagctcaacagtgttgggcgcgggtgta-----------aaatataccgcactctcttttttcttcttacagttctagaagaaaatctat |
36094537 |
T |
|
| Q |
99 |
aatatgggggaagcttgaatgggtctactggcaaggacaaaagtgggagatgaagaaatagtctcatttcttccttctttctttgtttgtgagtagagaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36094536 |
aatatgggggaagcttgaatgggtctactggcaagggcaaaagtgggagatgaagaaatagtctcatttcttccttctttctttgtttgggagtagagaa |
36094437 |
T |
|
| Q |
199 |
aagaaaaagttataggtcccgcatgtttttagtctccctttgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36094436 |
aagaaaaagttataggtcccgcatgtttttagtctctctttgc |
36094394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University