View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_147 (Length: 249)
Name: NF20665_low_147
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_147 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 42120712 - 42120481
Alignment:
| Q |
18 |
cagagacacttgtgttgccaaggtattacaagttatgtaaatgttgagttcctaaagagaatgcaacacttcaagtttatggactctggttaacatttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42120712 |
cagagacacttgtgttgccaaggtattacaagttatgtaaatgttgagttcctaaagagaatgcaacacttcaagtttatggactctggttaacatttag |
42120613 |
T |
 |
| Q |
118 |
tgtcagatcaatgtggcctaacaacttcaacatcagttaaaatttagggagcttcgtttctcaccccaaagtcactttgaaagtatatttccnnnnnnng |
217 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
42120612 |
tgtcagatcaatgtggcctaacgacttcaacatcagttaaaatttagggagcttcgtttctcaccccaaaggcactttgaaagtatatttccaaaaaaag |
42120513 |
T |
 |
| Q |
218 |
atgatatactgtttttctctctcttcagaaat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42120512 |
atgatatactgtttttctctctcttcagaaat |
42120481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University