View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_148 (Length: 249)
Name: NF20665_low_148
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_148 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 249
Target Start/End: Original strand, 51495981 - 51496212
Alignment:
| Q |
18 |
cgaatattatctggtctgattttgaaatctgaaccaaattatgtataatttaattaaagcattaattttggctaatggtctcagaagaaaattcatgatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51495981 |
cgaatattatctggtctgattttgaaatctgaaccaaattatgtataatttaattaaagcattaattttggctaatggtctcagaagaaaattcatgatt |
51496080 |
T |
 |
| Q |
118 |
ttcgtgcatcattatggcttgcttctttctcaagtcgttaattattattgcatcgagtttataactaataatgattgtgttacagtggatgcactttgct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51496081 |
ttcgtgcatcattatggcttgcttctttctcaagtcgttaattattattgcatcgagtttataactaataatgattgtgttacagtggatgcactttgct |
51496180 |
T |
 |
| Q |
218 |
gagagatccacgctacaacaaaggacttgcct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
51496181 |
gagagatccacgctacaacaaaggacttgcct |
51496212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University