View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_149 (Length: 249)
Name: NF20665_low_149
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_149 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 20273361 - 20273129
Alignment:
| Q |
1 |
ctttctgaagtatatggttattaacttattttatctgccatcggcctaatcattttgctcaaggcctgcataggctttcacatgccgttttcaactcctg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20273361 |
ctttctgaaatatatggttattaacttattttatccgccatcggcctaatcattttgctcaaggcctgcataggctttcacatgccgttttcaactcctg |
20273262 |
T |
|
| Q |
101 |
aagacaacggtcttagttggagaaaacgggggatcatgcgcctctaaagacgatggctgtgtgatgacaattaattatatgcagtgatttgagtttgata |
200 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20273261 |
aagacaacggtgttagctggagaaatcgggggatcatgcgcctctaaagatgatggctgtgtgatgacaattaattatatgcagtgatttgagtttgata |
20273162 |
T |
|
| Q |
201 |
tttgcatcccgacaccgaaacttgtttcaattt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20273161 |
tttgcatcccgacaccgaaacttgtttcaattt |
20273129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 44 - 233
Target Start/End: Complemental strand, 45892400 - 45892217
Alignment:
| Q |
44 |
gcctaatcattttgctcaaggcctgcataggctttcacatgccgttttcaactcctgaagacaacggtcttagttggagaaaacgggggatcatgcgcct |
143 |
Q |
| |
|
|||||||| ||||||||||||| ||| | ||||||||||||||| | |||| |||||||| |||||| |||| ||||| |||||||| |||||||||| |
|
|
| T |
45892400 |
gcctaatccttttgctcaaggcttgcgtgtgctttcacatgccgtct-caacccctgaagataacggtgttagctggagtaaacgggg-atcatgcgcca |
45892303 |
T |
|
| Q |
144 |
ctaaagacgatggctgtgtgatgacaattaattatatgcagtgatttgagtttgatatttgcatcccgacaccgaaacttgtttcaattt |
233 |
Q |
| |
|
|||| ||| | |||||||||||||||| |||||||||||||||||||||| ||||||| || ||| ||| |||||||||||| |
|
|
| T |
45892302 |
ctaacgacaacaactgtgtgatgacaattg----tatgcagtgatttgagtttgatttttgcataccaacatgaaaaattgtttcaattt |
45892217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University