View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20665_low_155 (Length: 246)

Name: NF20665_low_155
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20665_low_155
NF20665_low_155
[»] chr1 (2 HSPs)
chr1 (14-131)||(34365483-34365600)
chr1 (197-246)||(34365666-34365715)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 14 - 131
Target Start/End: Original strand, 34365483 - 34365600
Alignment:
14 aattaattcaaaacacattgattattgactagctagtgtgattaggtaagactcgagaagaaattatatttatagtgcatggccaatagataaagtatac 113  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
34365483 aattaattcaaaccacattgattattgactagctagtgtgattaggtaagactcgaaaagaaattatatttatagtgcatggccaatagataaagtatac 34365582  T
114 accactatctcaaacttc 131  Q
    ||||||||||||||||||    
34365583 accactatctcaaacttc 34365600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 197 - 246
Target Start/End: Original strand, 34365666 - 34365715
Alignment:
197 cataatatatagtaccgtctcaccactttcttgcattttgccaactattc 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
34365666 cataatatatagtaccgtctcaccactttcttgcattttgccaactattc 34365715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University