View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_165 (Length: 241)
Name: NF20665_low_165
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_165 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 1440752 - 1440519
Alignment:
| Q |
1 |
ctttgctgtctttgtaatagagcaccgtt------------gcctgtgtaagttatgacagaaaatccaaatagaatcttactaccaggagtagcagacc |
88 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||| || |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1440752 |
ctttgctgtctttgtaatagagcaccgttccttttggagcagcctgtttaaggtacgacagaaaatccaaatagaatcttactaccgggagtagcagacc |
1440653 |
T |
 |
| Q |
89 |
aaagaaagagaaattctgctgaaatcaagcactcgtttacttgcattcttgtgcgcgcccgcgcacacgcacacacctatttacagatgttaaataaaca |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1440652 |
aaagaaagagaaattctgctgaaaccaagcactcgtttacttgcattcttttgcgcgcccacccacacgcacacacctatttacagatgttaaataaaca |
1440553 |
T |
 |
| Q |
189 |
gatatattattggacagaattcaacgcgcatgtt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1440552 |
aatatattattggacagaattcaacgcgcatgtt |
1440519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 76 - 121
Target Start/End: Complemental strand, 41704491 - 41704446
Alignment:
| Q |
76 |
ggagtagcagaccaaagaaagagaaattctgctgaaatcaagcact |
121 |
Q |
| |
|
|||| ||||| |||| |||||||||||| ||||||||||||||||| |
|
|
| T |
41704491 |
ggagaagcaggccaaggaaagagaaattgtgctgaaatcaagcact |
41704446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University