View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_169 (Length: 239)
Name: NF20665_low_169
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_169 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 3807173 - 3807395
Alignment:
| Q |
1 |
caccagaaagaagggtgctatcacctcttgccgagactgcttaatgagggaagtttttaggaggcttcacaaaactggtttcaatattgctatttgtaaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807173 |
caccagaaagaagattgctatcacctcttgccgagactgcttaatgagggaagtttttacgaggcttcacaaaactggtttcaatattgctatttgtaaa |
3807272 |
T |
|
| Q |
101 |
acaaaatggagaacttcatcagatattccatcaggtaaatgtcatttattgctaacaaatatagttatgaaaagcaatattattagaatttacgaccttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3807273 |
acaaaatggagaacttcatcagatattccatcaggtatatgtgatttattgctaacaaatatagttatgaaaagcaatattattagaatttacgaccttc |
3807372 |
T |
|
| Q |
201 |
ggatataagaaccggaaaatgat |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3807373 |
agatataagaaccggaaaatgat |
3807395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 13 - 137
Target Start/End: Original strand, 3775231 - 3775355
Alignment:
| Q |
13 |
gggtgctatcacctcttgccgagactgcttaatgagggaagtttttaggaggcttcacaaaactggtttcaatattgctatttgtaaaacaaaatggaga |
112 |
Q |
| |
|
|||||| |||||| | ||| || ||||||||||||||||||||| || ||||||||| ||| |||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
3775231 |
gggtgccatcaccacctgcagaaactgcttaatgagggaagtttctatgaggcttcagaaagctggtttcaatagtgctatttgcaaaacaaaatggaga |
3775330 |
T |
|
| Q |
113 |
acttcatcagatattccatcaggta |
137 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
3775331 |
acttcatcagatattccgtcaggta |
3775355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University