View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_170 (Length: 239)
Name: NF20665_low_170
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_170 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 230
Target Start/End: Complemental strand, 15381474 - 15381261
Alignment:
| Q |
17 |
aattactatttacagtgtaaaagtggtttcatccaactcatcgtgattccaaacatggatgtcgtatctagttatgaaacattgtatttggatcaaccat |
116 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15381474 |
aattactgtttacagtgtaaaagtggtttcatcaaactcatcgtgattttaaacatggatgtcatatctagttatgaaacattgtatttggatcaaccat |
15381375 |
T |
 |
| Q |
117 |
gactgaatcctttataagattcatgcatagatttcatcaagagcagaattcattcaagggtcaattaagaagctgatatataaaatgaatgaaagtaaag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
15381374 |
gactgaatcctttataagattcatgcatagatttcatcatgagcagaattcattcaagggtcaattaagaagctgatatatagaatgaaagaaagtaaag |
15381275 |
T |
 |
| Q |
217 |
gagatatgtgaaaa |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15381274 |
tagatatgtgaaaa |
15381261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University