View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_176 (Length: 238)
Name: NF20665_low_176
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_176 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42744555 - 42744335
Alignment:
| Q |
1 |
tttttacagttatccactatgaattgctttgagaagtccttccccagactttgatcacccatagctgcttccagcagtaactgcatcaaatccttttctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42744555 |
tttttacagttatccactatgaattgctttgagaagtccttccccagactttgatcactcatggctgcttccagcagtaactgcatcaaatccttttctg |
42744456 |
T |
|
| Q |
101 |
atgagcattctcgctttcgctcctccactaactcccatatcagtgactctatctcgctctccaaactgcttatttcatcttgcttctttgttcgaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42744455 |
atgagcattctcgctttcgctcctccactaactcccatatcagtgactctatctcgctctccaaactgcttatttcatcttgcttctttgttcgaaattt |
42744356 |
T |
|
| Q |
201 |
cagtttctccctgcagccatt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42744355 |
cagtttctccctgcagccatt |
42744335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University