View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_189 (Length: 235)
Name: NF20665_low_189
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_189 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 30 - 216
Target Start/End: Complemental strand, 41409574 - 41409388
Alignment:
| Q |
30 |
tttttcatatgcgccggtagttgactacatgcttaaggggactaagcatattcattgagtctttaaataactataaatacatttttgaagatttatggaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41409574 |
tttttcatatgcgccggtagttgactacatgcttaaggggactaagcatattcattgagtctgtaaataactataaatacatttttgaagatttatggaa |
41409475 |
T |
 |
| Q |
130 |
ctacgaagtgtagtagtacatctacggcaccaaataaaagttcacgttttaactttatacatatacgcacaaaaatttggttagttt |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41409474 |
ctacgaagtgtagtagtacatctgcggcaccaaataaaagttcacgttttaactttatacatatacgcacaaaaatttggttagttt |
41409388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University