View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_196 (Length: 226)
Name: NF20665_low_196
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_196 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 6 - 226
Target Start/End: Original strand, 50993713 - 50993948
Alignment:
| Q |
6 |
aagtgagtggtgaagatgagttgttttctgatttggagaaggatgataatgttctttcacctgttccaatttcag------tatcagagaagcagtttat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
50993713 |
aagtgagtggtgaagatgagttgttttctgatttggagaaggatgataatgttctttcacctgttccaatatcagtatcagtatcagagaagcagtttat |
50993812 |
T |
 |
| Q |
100 |
tccactcctcagtggcttacaaggagaaggcaatgccatcaatgagaaacaagcaggtgaacgaaagaggaagcggggggttgcaactgaaggcaat--- |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50993813 |
tccactcctcagtggcttacaaggagaaggcaatgccatcaatgagaaacaaccaggtgaacgaaagaggaagcggggggttgcaactgaaggcaatatt |
50993912 |
T |
 |
| Q |
197 |
------gaagaggaggaaagtgtgcaaagtgaatta |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50993913 |
gaagaggaagaggaggaaagtgtgcaaagtgaatta |
50993948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 51
Target Start/End: Complemental strand, 6526737 - 6526692
Alignment:
| Q |
6 |
aagtgagtggtgaagatgagttgttttctgatttggagaaggatga |
51 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
6526737 |
aagtgagtggtgaagatgggttgttttctgattttgagaaggatga |
6526692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 135
Target Start/End: Complemental strand, 6525903 - 6525852
Alignment:
| Q |
84 |
cagagaagcagtttattccactcctcagtggcttacaaggagaaggcaatgc |
135 |
Q |
| |
|
|||||||||||||| | ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
6525903 |
cagagaagcagtttctaccactcctccgtggctgccaaggagaaggcaatgc |
6525852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University