View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_206 (Length: 204)
Name: NF20665_low_206
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_206 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 183
Target Start/End: Complemental strand, 24572818 - 24572649
Alignment:
| Q |
13 |
ataattctacacgtacgggttacatttatgaattatggatttgtttaannnnnnnnnnnnnataaagaaagtatatattctatctacttcacattgaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
24572818 |
ataattctacacgtacgggttacatttatgaattatggatttgtttaattttttatattt-ataaagaaagtatatattcaatctacttcagattgaaaa |
24572720 |
T |
|
| Q |
113 |
caattgatacaaatacccgtgattttacgaaaacaattgaatatattacgaaaaaagatgcttttttatta |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24572719 |
caattgatacaaatacccgtgattttacgaaaacaattgaatatattacgaaaaaggatgcttttttatta |
24572649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University