View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_55 (Length: 372)
Name: NF20665_low_55
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 146 - 347
Target Start/End: Complemental strand, 39387458 - 39387257
Alignment:
| Q |
146 |
atttaaatccaagtgtcctataatacacacattgtttaatatttgttagattttagaacaattagtcacgccatgccttcacatccacgggtcgactacg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39387458 |
atttaaatccaagtgtcctataatacacacattgtttaatatttgttagactttagaccaattagtcacgccatgccttcacatccacgggtcgactacg |
39387359 |
T |
|
| Q |
246 |
cttaccaaagctcaactgcttgaaacaacctcttttatattccttcttaactttgttgacaagtttttatcacattattcttcattgattttcgttcttt |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39387358 |
cttaccaaagctcaactgcttgaaacaacctcttttatattccttcttaactttgttgacaagtttttatcacattattcttcattgattttcgttcttt |
39387259 |
T |
|
| Q |
346 |
gt |
347 |
Q |
| |
|
|| |
|
|
| T |
39387258 |
gt |
39387257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 16 - 144
Target Start/End: Complemental strand, 39387734 - 39387606
Alignment:
| Q |
16 |
atattctcaactaagattatgggagcatgtgtgaatcaagttgtacaaatctgtgtagtaaggattagacaaagcttaagacaaaatgccagtgagaaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
39387734 |
atattctcaactaagattatgggagcatgtgtgaatcaagttgtacaaatctgtgcagtaagcattagacaaagcacaagacaaaatgccagtgagaaat |
39387635 |
T |
|
| Q |
116 |
aaacttggtgttaagaagcagccacttag |
144 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
39387634 |
aaacctggtgttaagaagcagccacttag |
39387606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University