View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_76 (Length: 329)
Name: NF20665_low_76
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 3965054 - 3964807
Alignment:
| Q |
18 |
aaattagggtttgtcaacctgctacattgctggcaaaacctttgttgaagctctgaaatgagtacggaatgagccttagaatggttttcacaaaccttat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3965054 |
aaattagggtttgtcaacctgctacattgctggcaaaacctttgttgaagctctgaaatgagtacggaatgagccttagaatggttttcacaaaccttat |
3964955 |
T |
 |
| Q |
118 |
ggcgcttatggtactgcttagcaacacttagatcagcattacagttatcaacttggcaagaaggtgtcactgatcctccagcttttgaccctttcttgtt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3964954 |
ggcgcttatggtactgcttagcagcacttagatcagcattacagttatcaacttggcaagaaggtgtcactgatcctccagcttttgaccctttcttgtt |
3964855 |
T |
 |
| Q |
218 |
gtaaagatgatcagtcaccacccttttctttttctcatcatctccata |
265 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3964854 |
gtaaagatgatcagtcaccacccttttccttttctcatcatctccata |
3964807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University