View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_77 (Length: 324)
Name: NF20665_low_77
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 17 - 312
Target Start/End: Original strand, 36285148 - 36285444
Alignment:
| Q |
17 |
ataattgtgtaaacttaagacaatgaattggtatgttaagattaatttattctggtgatcattaaggttgatttattagggtgattttc-aaattaggga |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36285148 |
ataattgtgtaaacttaagataatgaattggtatgttaagattaatttattctggtgatcattaaggttgatttattagggtgattttccaaattaggga |
36285247 |
T |
|
| Q |
116 |
atacccttgagtgtgttagtcgattaaatggtttcgttaatcgattgttaagttaaatgattgattcagtatctattaggtaatgatccaatatgattgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36285248 |
atacccttgagtgtgttagtcgattaaatggtttcgttaatcgattgttaagttaaatgattgattcagtatctattaggtaatgatccaatatgattgt |
36285347 |
T |
|
| Q |
216 |
tgcattcttaattgcaggcataattatgttctctgtgctagtctgcagcattgtatcatctcgaagttttttgctggttttagtttgtgtgtttctc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
36285348 |
tgcattcttaattgcaggcataattatgttctctgtgctagtctgcagcattgtatcatctcgaagttttttgttggttttagtttctgtgtttctc |
36285444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University