View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_97 (Length: 288)
Name: NF20665_low_97
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_97 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 46 - 271
Target Start/End: Complemental strand, 25198746 - 25198515
Alignment:
| Q |
46 |
ttagatgcactgaaatgttttgcttataatttttcaaa----agatgtgtctaatattgaattacattt--aagttatgtttaaattgaaagtgagttaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25198746 |
ttagatgcactgaaatgttttgcttataatttttctcttttcatatgtgtctaatattgaattacatttttaagttatgtttaaattgaaagtgagttag |
25198647 |
T |
 |
| Q |
140 |
gcataatcacatggactaatgtgattttggtaaaaagataaataatgttaggagcttcaaaatcacggtagtctataatttggtcaaattcaccgtcaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25198646 |
gcataatcacatggactaatgtgattttggtaaaaagataaataatgttaggagcttcaaaatcacggtagtccataatttggtcaaattcaccgtcaat |
25198547 |
T |
 |
| Q |
240 |
ctagacgtacactagttggactcggatacatt |
271 |
Q |
| |
|
| | || |||| || ||||||||||||||||| |
|
|
| T |
25198546 |
ccaaacatacattatttggactcggatacatt |
25198515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 40
Target Start/End: Complemental strand, 25198811 - 25198781
Alignment:
| Q |
10 |
attatactttggaacttcaataaaataaagt |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
25198811 |
attatactttggaacttcaataaaataaagt |
25198781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University