View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20665_low_99 (Length: 285)
Name: NF20665_low_99
Description: NF20665
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20665_low_99 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 237
Target Start/End: Original strand, 15380738 - 15380961
Alignment:
| Q |
14 |
agagcagttatatcaattgggttgaaactttggaatctgaactatttcttataatgggtttttcttagtcaatctcctcattttggacagtatgctttct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380738 |
agagcagttatatcaattgggttgaaactttggaatttgaactatttcttataatgggtttttcttagtcaatctcctcattttggacagtatgctttct |
15380837 |
T |
|
| Q |
114 |
tctttcaacttgcacaagtcactttgatgggatcccacagttnnnnnnnntgttactagtagtaagttgaagctagctgcattgtgtggacttttggagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15380838 |
tctttcaacttgcacaagtcactttgatgggatcccacagttaaaaaaaatgttactggtagtaagttgaagctagctgcattgtgtggacttttggagt |
15380937 |
T |
|
| Q |
214 |
gtgcaatgcacgtgagtatgtgtg |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
15380938 |
gtgcaatgcacgtgagtatgtgtg |
15380961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University