View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20667_low_12 (Length: 233)
Name: NF20667_low_12
Description: NF20667
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20667_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 139 - 215
Target Start/End: Complemental strand, 12305616 - 12305540
Alignment:
| Q |
139 |
tggcttggtaaatgaacatgaaggtaatgcatcatagactcatagtgaatcaaattctataaatgaatggaaaaagg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12305616 |
tggcttggtaaatgaacatgaaggtaatgcatcatagactcatagtgaatcaaattctataaatgaaaggaaaaagg |
12305540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 63
Target Start/End: Complemental strand, 12305750 - 12305692
Alignment:
| Q |
4 |
attattcttaaccaggaaaaaatagggggacaaagaaaattggagggttgaaactgaaaa |
63 |
Q |
| |
|
|||||||| |||| ||||||| |||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
12305750 |
attattctcaaccgggaaaaactagggg-ataaagaaaatcggagggttgaaactgaaaa |
12305692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University