View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20668_high_10 (Length: 334)
Name: NF20668_high_10
Description: NF20668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20668_high_10 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 186 - 334
Target Start/End: Complemental strand, 31924583 - 31924435
Alignment:
| Q |
186 |
catcttgttcatctaattcaaaccttctagttctatctttattccagatactaggtgtaccataattttcaaatctgaaatagatttacaggtatagcca |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31924583 |
catcttgttcatctaattcaaaccttctagttctttctttattgcagatactaggtgtaccatatttttcaaatctgaaatagatttacaggtatagcca |
31924484 |
T |
|
| Q |
286 |
ctattcttgtcaattttgtatacatgctttctgatttttagtatttttc |
334 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
31924483 |
ctattcttgtcaattttgtatacattctttctgattattagtatttttc |
31924435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 8e-49
Query Start/End: Original strand, 15 - 121
Target Start/End: Complemental strand, 31924750 - 31924644
Alignment:
| Q |
15 |
acaaaatacatctttcttatagtttctactttttcatgctctcaatcatgttcaccaatacttctactgcttcaaccattaaatgtctaggtatgcaatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31924750 |
acaaaatacatctttcttatagtttctacttttttatgctctcaatgatgttcaccaatacttctactgcttcaaccattaaatgtctaggtatgcaatt |
31924651 |
T |
|
| Q |
115 |
cttcctc |
121 |
Q |
| |
|
||||||| |
|
|
| T |
31924650 |
cttcctc |
31924644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University