View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20668_high_21 (Length: 227)
Name: NF20668_high_21
Description: NF20668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20668_high_21 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 9634139 - 9633920
Alignment:
| Q |
8 |
atcctacagttgcaattgcggctgctgcaaatgttgattgcggggtatccatatccctaactgttccacaacatacttttggtgaagttagaattcgagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9634139 |
atcctacagttgcaattgcggctgctgcaaatgttgattgcagggtatccatatccctaactgttccacaacatacttttggtgaagttagaattcgagg |
9634040 |
T |
|
| Q |
108 |
gcatggtccaacaatggatgacataaaatttagaaaatatatctctctgtaactatttttagtacatattttaatcataacaaacagaacaaaattaatg |
207 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9634039 |
gcatggtccaacaatggatggcataaaatttagaaaatatatctctctgtaactatttttagtacatattttaatcataacaaacaaaacaaaattaatg |
9633940 |
T |
|
| Q |
208 |
tttgacttgaatatgttttt |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9633939 |
tttgacttgaatatgttttt |
9633920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University