View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20668_low_16 (Length: 238)
Name: NF20668_low_16
Description: NF20668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20668_low_16 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 135 - 238
Target Start/End: Complemental strand, 27491518 - 27491415
Alignment:
| Q |
135 |
gcttgtattgcgaaatatttttggtgaaatgtaatctaaaatagacattaacttattatacccataaatagctnnnnnnntatattatacctaatgactt |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27491518 |
gcttgtattgcgaaatatatttggtgaaatgtaatctaaaatagacatcaacttattatacccataaatagctaaaaaaatatattatacctaatgactt |
27491419 |
T |
|
| Q |
235 |
gcat |
238 |
Q |
| |
|
|||| |
|
|
| T |
27491418 |
gcat |
27491415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 135 - 206
Target Start/End: Complemental strand, 27484227 - 27484156
Alignment:
| Q |
135 |
gcttgtattgcgaaatatttttggtgaaatgtaatctaaaatagacattaacttattatacccataaatagc |
206 |
Q |
| |
|
||||||| || |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27484227 |
gcttgtactgtgaaatatttttggtgagatgtaatctaaaatagacatcaacttattatacccataaatagc |
27484156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 27484345 - 27484293
Alignment:
| Q |
17 |
aacattaattttactttgtatgattcataaatttttcattcggtgaaattgtt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27484345 |
aacattaattttactttgtatgattcataaatttttcattcggtgaaattgtt |
27484293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University