View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20668_low_24 (Length: 220)
Name: NF20668_low_24
Description: NF20668
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20668_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 203
Target Start/End: Original strand, 41520689 - 41520876
Alignment:
| Q |
17 |
cagagaaagataaataaaaggagttgaaaaaagagaagcttataaataaatagttatggtattgtacgaaaacaaaatatttattggtatcgtaaaataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41520689 |
cagagaaagataaataaaaggagttgaaaaaagagaagcttataaataaatagttatggtattgtacgaaaacaaaatatttattggtattgtaaaataa |
41520788 |
T |
|
| Q |
117 |
aatacaaacgtctataaatcttggttcaaac-nnnnnnntgcagaaattatgaggttggacgctctgatcgaagtttgaaccttgatt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
41520789 |
aatacaaacgtctataaatcttggttcaaacaaaaaaattgcagaaattatgaggttggacgctgtgaccgaagtttgaaccttgatt |
41520876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University