View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20669_high_5 (Length: 211)
Name: NF20669_high_5
Description: NF20669
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20669_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 6164427 - 6164373
Alignment:
| Q |
1 |
ttcacttcataaatcttgaaatctattgcctaataatgaaacaactcaagatata |
55 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
6164427 |
ttcacttcataaatcttgaaatcaatggcctaataatgaaacaactcaagatata |
6164373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 13282988 - 13283042
Alignment:
| Q |
1 |
ttcacttcataaatcttgaaatctattgcctaataatgaaacaactcaagatata |
55 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
13282988 |
ttcacttcataaatcttgaaatctatggcctaataataaaacaactcaagatata |
13283042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 85 - 174
Target Start/End: Complemental strand, 6138466 - 6138377
Alignment:
| Q |
85 |
aagtttcgataaaataatttgcatttgagatcacttttctaatttttctgatggagtatgcaatgtaacgatatccatgtaagagtattt |
174 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||| || |||||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
6138466 |
aagtttcaataaaataatttgtatttgtgatcactattttaatttttctgatggactatgcaatgtaatatcatccacgtaagagtattt |
6138377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 85 - 174
Target Start/End: Original strand, 13283948 - 13284037
Alignment:
| Q |
85 |
aagtttcgataaaataatttgcatttgagatcacttttctaatttttctgatggagtatgcaatgtaacgatatccatgtaagagtattt |
174 |
Q |
| |
|
||||||| ||||||||||||| ||||| ||||||| || |||||||||||||||| |||||||||||| ||||| |||||||||||| |
|
|
| T |
13283948 |
aagtttcaataaaataatttgtatttgtgatcactattttaatttttctgatggactatgcaatgtaatatcatccacgtaagagtattt |
13284037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 6139104 - 6139058
Alignment:
| Q |
9 |
ataaatcttgaaatctattgcctaataatgaaacaactcaagatata |
55 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6139104 |
ataaatcttgaaatctatggcctaataatgaaacaactcaagatata |
6139058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 89
Target Start/End: Original strand, 13283261 - 13283296
Alignment:
| Q |
54 |
taactttggattaatctgtaaaggaaaatgcaagtt |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13283261 |
taactttggattaatctgcaaaggaaaatgcaagtt |
13283296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University