View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2066_low_18 (Length: 203)

Name: NF2066_low_18
Description: NF2066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2066_low_18
NF2066_low_18
[»] chr1 (1 HSPs)
chr1 (134-187)||(14888822-14888875)


Alignment Details
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 134 - 187
Target Start/End: Complemental strand, 14888875 - 14888822
Alignment:
134 tttcattattccttttgattttgagagtcttttcccattgttctatagtccttt 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
14888875 tttcattattccttttgattttgagagtcttttcccattgttctatattccttt 14888822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University