View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20671_high_19 (Length: 327)
Name: NF20671_high_19
Description: NF20671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20671_high_19 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 15 - 309
Target Start/End: Complemental strand, 81122 - 80834
Alignment:
| Q |
15 |
gaatcagtatcattgaatattaagttcttcacatacatgtccacgatgtgaacacccaaaaatcaacatgcagatcaaatgattcacattcaatcaacat |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81122 |
gaatcagtatcattgaatattaatttcttcacat----gtccacaatgtgaacacccaaaaatcaacatgcagatcaaatgattcacattcaatcaacat |
81027 |
T |
|
| Q |
115 |
ttcaacaataaaacnnnnnnnnctttgaaactcggtatccggctcaaggaccagctagtgcaacaatcccgccctccaatagcgggcgggcttaattgaa |
214 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81026 |
ttcaacaataaaacttttttt-ctttgaaactcggtatccagctcaaggaccagctagtgcaacaatcccgccctccaatagcgggcgggcttaattgaa |
80928 |
T |
|
| Q |
215 |
acttaaagcaaatacctctatggaccggcccaaaacatgaattgttagcaccaagaggattcgaacctgagacctggagagtagcagactccgag |
309 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
80927 |
ac-tagagcaaatacctctatggaccggcccaaaacatgaattgttagcatcgagagggttcgaacctgagacctggagaggagcagactccgag |
80834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 242 - 300
Target Start/End: Complemental strand, 22779760 - 22779702
Alignment:
| Q |
242 |
gcccaaaacatgaattgttagcaccaagaggattcgaacctgagacctggagagtagca |
300 |
Q |
| |
|
|||||| |||||||||||| | ||| |||||||||||||||||||||| ||||| |||| |
|
|
| T |
22779760 |
gcccaacacatgaattgtttgtacctagaggattcgaacctgagaccttgagaggagca |
22779702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 233 - 295
Target Start/End: Original strand, 13758787 - 13758849
Alignment:
| Q |
233 |
tatggaccggcccaaaacatgaattgttagcaccaagaggattcgaacctgagacctggagag |
295 |
Q |
| |
|
||||||| ||| ||| ||| |||||||||||||| ||||||||||||| ||||||| ||||| |
|
|
| T |
13758787 |
tatggactggctcaacacaagaattgttagcaccgggaggattcgaaccagagacctagagag |
13758849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University