View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20671_low_30 (Length: 257)
Name: NF20671_low_30
Description: NF20671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20671_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 33768286 - 33768360
Alignment:
| Q |
29 |
cgcaagtatactttggatttgctctttgacaatgaccatgttgct-tgaagccttgttctactccctatgactct |
102 |
Q |
| |
|
||||| ||||||||||||||||||| | ||| || |||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33768286 |
cgcaaatatactttggatttgctctcttacagtggccatcttgctgtgaagccttgttctactccctatgactct |
33768360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 255
Target Start/End: Complemental strand, 30701081 - 30701033
Alignment:
| Q |
207 |
ttttcaggcagctactcgtgtcttgaagtatttgaagagcttctcaaca |
255 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30701081 |
ttttcagaaagctactcatgtcttgaagtatttgaagagcttctcaaca |
30701033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 103
Target Start/End: Complemental strand, 35517732 - 35517657
Alignment:
| Q |
29 |
cgcaagtatactttggatttgctctttgacaatgaccatgttgct-tgaagccttgttctactccctatgactctc |
103 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| | |||| ||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
35517732 |
cgcaagtatactttggattttctctctgacatcggccatcttgttgtgaagccttattctactccctatgactctc |
35517657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 102
Target Start/End: Complemental strand, 12472925 - 12472853
Alignment:
| Q |
31 |
caagtatactttggatttgctctttgacaatgaccatgttgct-tgaagccttgttctactccctatgactct |
102 |
Q |
| |
|
|||||||||||||||||| |||| ||||| | |||| |||| |||| ||||||||||||||| |||||||| |
|
|
| T |
12472925 |
caagtatactttggattttctctctgacagaggccatcttgccgtgaacccttgttctactccccatgactct |
12472853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University