View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20671_low_31 (Length: 253)
Name: NF20671_low_31
Description: NF20671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20671_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 82
Target Start/End: Original strand, 19642753 - 19642831
Alignment:
| Q |
4 |
gaattattgagataaagagataatgcannnnnnnaaaagtcgaccataattactttacttttccccggttttacaatga |
82 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
19642753 |
gaattattgagataaagagataatgcatttttttaaaagtcgaccataattactttacttttgcccggttttataatga |
19642831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 149 - 220
Target Start/End: Original strand, 19642972 - 19643043
Alignment:
| Q |
149 |
atttttattatctcgtaaaattaacataaattttagaaataaaaaatgttttcacaaaataaacatggccag |
220 |
Q |
| |
|
||||||||||| | |||||||||| |||||||| ||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
19642972 |
atttttattattttgtaaaattaaaataaatttaagaaataaaaaatgttttcacaaaatatacatgaccag |
19643043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 204
Target Start/End: Original strand, 37772826 - 37772868
Alignment:
| Q |
163 |
gtaaaattaacataaattttag-aaataaaaaatgttttcaca |
204 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
37772826 |
gtaaaattaacacaaattttaggaaataaaaaatgttttcaca |
37772868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University