View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20671_low_32 (Length: 252)
Name: NF20671_low_32
Description: NF20671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20671_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 43854025 - 43853791
Alignment:
| Q |
1 |
ttgttcttttagttagccttttgagacttgagagattcattcatgccttcactgatgagcttatataatatagtcatttaaacatgttactcatcaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43854025 |
ttgttcttttagttagccttttgagacttgagagattcattcatgccttcactgatgagcttatataatatagtcatttaaacatgttactcatcaataa |
43853926 |
T |
|
| Q |
101 |
gagggaaaagtatcataattcttccaagtcttactaaattctctatggatccttcgatcatccaaggtaaggtacgtgataactatattacaaaggtttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43853925 |
gagggaaaagtatcataattcttccaagtcttactaaattctctatggatccttcgatcatccaaggtaaggtacgtgataactatattacaaaggtttc |
43853826 |
T |
|
| Q |
201 |
tataatatttatgttataccattggtatccatgat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
43853825 |
tataatatttatgttataccattggtatccatgat |
43853791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University