View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20671_low_33 (Length: 250)
Name: NF20671_low_33
Description: NF20671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20671_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 17142435 - 17142290
Alignment:
| Q |
1 |
attaacttgatataataaaatgacaagaattatcttaagaatatctgtttggtgactgtgtggtcaaatcaagtgcaatgtaaagtgactctcaattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17142435 |
attaacttgatataataaaatgacaagaattatcttaagaatatctgtttggtgactgtgtggtcaaatcaagtgcaatgtaaagtgactctcaattatt |
17142336 |
T |
|
| Q |
101 |
gtaacatttctcatcttctaattaactcatcactcatcctcctttt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17142335 |
gtaacatttctcatcttctaattaactcatcactcatcctcctttt |
17142290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 184 - 240
Target Start/End: Complemental strand, 17142252 - 17142196
Alignment:
| Q |
184 |
cataaatggcccacatgctatctcttttagcctcttgtgggcttcaatcaccctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17142252 |
cataaatggcccacatgctatctcttttagcctcttgtgggcttcaatcaccctttg |
17142196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University