View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20671_low_8 (Length: 455)
Name: NF20671_low_8
Description: NF20671
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20671_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 305; Significance: 1e-171; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 127 - 439
Target Start/End: Original strand, 27986606 - 27986918
Alignment:
| Q |
127 |
tgatttaaataagataacatatattaatcatatcttgtctctctatcttgaccatcaaatggaagtaccatgttgaaaagtgaaaagtgaatctgctgaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27986606 |
tgatttaaataagataacatatattaatcatatcttgtctctctatcttgaccatcaaacggaagtaccatgttgaaaagtgaaaagtgaatctgctgaa |
27986705 |
T |
|
| Q |
227 |
ctggtaatggcatggaatgcatgcacacggcgttttgtagtatttacaaatttcttactgatattatgagaaatatgtcaaaattgtttcatgaaaaaca |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27986706 |
ctggtaatggcatggaatgcatgcacacggcattttgtagtatttacaaatttcttactgatattatgagaaatatgtcaaaattgtttcatgaaaaaca |
27986805 |
T |
|
| Q |
327 |
ccggacatgtcgcataccacctttgcctttacattagacaacataggcaaccgtcaccagttctagaaccaaataatcatgggatatggttcccttgata |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27986806 |
ccggacatgtcgcataccacctttgcctttacattagacaacataggcaaccgtcaccagttctagaaccaaataatcatgggatatggttcccttgata |
27986905 |
T |
|
| Q |
427 |
agtagacgctact |
439 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27986906 |
agtagacgctact |
27986918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 58 - 128
Target Start/End: Original strand, 27985769 - 27985839
Alignment:
| Q |
58 |
caaagtcttggtcactaacactctctgctagttacgataccctaatgtcttaggtgactccataaccattg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27985769 |
caaagtcttggtcactaacactctctgctagttacgataccctaatgtcttaggtgactccataaccattg |
27985839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 285 - 432
Target Start/End: Original strand, 28066573 - 28066723
Alignment:
| Q |
285 |
tgatattatgagaaatatgtcaaaattgtttcatgaaaaacaccggacatgtcgcata---ccacctttgcctttacattagacaacataggcaaccgtc |
381 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| ||||||||| ||| || | |||| |||||||| |||||||||| || || |||| || ||| |
|
|
| T |
28066573 |
tgatattatgagaaacatgagaaaattgtttcacgaaaaacactagacctgacacatattaccaccttttcctttacattgcacgtcaaaggcgactgtc |
28066672 |
T |
|
| Q |
382 |
accagttctagaaccaaataatcatgggatatggttcccttgataagtaga |
432 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
28066673 |
accggttctagaaccaaataatcatgggatatagttaccttggtaagtaga |
28066723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 27985757 - 27985695
Alignment:
| Q |
1 |
ttgatcaaatgtcataaactaggttatctagacagctgcattcataatatttagttacaaagt |
63 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27985757 |
ttgatcaaatgtcgtaaactaggttatctagacaattgcattcataatatttagttacaaagt |
27985695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University