View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20672_high_5 (Length: 324)
Name: NF20672_high_5
Description: NF20672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20672_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 43949345 - 43949116
Alignment:
| Q |
1 |
tcttgctttcatcgcctttgctattagctcacttatctccggttacaacctatgtaatcgttacccctagtaatactttaaccttat---actatttatc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43949345 |
tcttgctttcatcgcctttgctattagctcacttatctccggttacaacctatgtaatcgttacccctagtaatactttaaccttatactactatttatc |
43949246 |
T |
|
| Q |
98 |
gatttatacttttttctttcttactaccatggagaaatgtattcaaaataactt-gagtctcgtgaattttaactgtatagacagacttttgtacactta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43949245 |
gatttatacttttttctttcttactaccatggagaaatgtattcaaaataacttcgagtctcgtgaattttaactgtatagacagacttttgtacactta |
43949146 |
T |
|
| Q |
197 |
tacttgcatgatattggaggatgaggatga |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43949145 |
tacttgcatgatattggaggatgaggatga |
43949116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University