View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20672_low_9 (Length: 247)
Name: NF20672_low_9
Description: NF20672
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20672_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 26846123 - 26845914
Alignment:
| Q |
20 |
ggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctccttacttttgagcgttttggagatttgggttttgttttgaaggca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846123 |
ggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctccttacttttgagcgttttggagatttgggttttgttttgaaggca |
26846024 |
T |
|
| Q |
120 |
aagtggggatggggacaaaagaattatgggatttagattccaaatttaatgtaggaaaggtgcaatgtgagccgatcgattttaaatcaatggccgagat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846023 |
aagtggggatggggacaaaagaattatgggatttagattccaaagttaatgtaggaaaggtgcaatgtgagccgatcgattttaaatcaatggccgagat |
26845924 |
T |
|
| Q |
220 |
caactaatgc |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
26845923 |
caactaatgc |
26845914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University