View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20673_high_13 (Length: 248)
Name: NF20673_high_13
Description: NF20673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20673_high_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 52025655 - 52025892
Alignment:
| Q |
11 |
agaatatgatgaggaagttgtatttttgcggatgttccctcattcacttataagtaaatctaaatacatgtgtgtgaaccaaaattttaaaataatgaaa |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
52025655 |
agaatatgacgaggaagttgtatttttgcggatgttccctcattcacttataagtaaatctaaatacatgtatgtgaaccaaaattttaagataatgaaa |
52025754 |
T |
|
| Q |
111 |
gattggaatgcactttaggagaaatttttcagcaagttttttccatgtaacaagttcatggaggctaagcgaaatgttgttgtgttctattatggttcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
52025755 |
gattggaatgcactttaggagaaatttttcagcaagttctttccatgtaacaagttcatggaggctaagagaattgttgttgtgttctattatggttcaa |
52025854 |
T |
|
| Q |
211 |
ctagaccattttgtgaagcatgagagagatacaaggcc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52025855 |
ctagaccattttgtgaagcatgagagagatacaaggcc |
52025892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University