View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20673_low_1 (Length: 670)
Name: NF20673_low_1
Description: NF20673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20673_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 8e-29; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 550 - 635
Target Start/End: Original strand, 35920114 - 35920199
Alignment:
| Q |
550 |
gttgaatccgcatgtttttctttcaatctatgaaatgaaattgatgtctattttagatactgaatagttgtattagtgctttatat |
635 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||| | |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35920114 |
gttgaatccgaatgtttttctttcaatctatgaaattaaattgatttgtattttagatactggatagttgtattagtgctttatat |
35920199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 382 - 447
Target Start/End: Original strand, 35919935 - 35920000
Alignment:
| Q |
382 |
agaaagaaaactcttgttctctcacttatctctctcctagcttccactcctttcgcaaaaaactac |
447 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
35919935 |
agaaagaaaactcttgttctctcacttgtatctctccaagcttccactcctttcgcaaaagactac |
35920000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 256 - 307
Target Start/End: Original strand, 35919844 - 35919895
Alignment:
| Q |
256 |
cagaggcctttggattatatcttttgatctttacccttggatgtaataattt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35919844 |
cagaggcctttggattatatcttttgatctccacccttggatgtaataattt |
35919895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University