View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20673_low_10 (Length: 253)
Name: NF20673_low_10
Description: NF20673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20673_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 52026337 - 52026570
Alignment:
| Q |
1 |
cctcccgttcaatttcatatccaattgacgaaggtgacaaagtatttggg-ttgtctgatatttgctagaggttaatcgagtgcctatccctcacaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
52026337 |
cctcccgttcaatttcatatccaattgaccaagctgacaaagtatttggggttgtctgatatttgctagaggttaaccgagtgcctacccctcacaaatg |
52026436 |
T |
|
| Q |
100 |
ataaagaatctctacaactattacatcgaaatgaccgtttgtaaaatgttatttatgaggggtaaaaccctagcaaacacacacaaactcctcacctttt |
199 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||| || |
|
|
| T |
52026437 |
ataaagaatgtctacaactattacatcgaaatgaccgtttgtaaaatgttatttatgtggggtaaaaccctcgcaaacacacacacactcctcacctgtt |
52026536 |
T |
|
| Q |
200 |
tcgaccaattcattacaaatatgcttgtttttca |
233 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||| |
|
|
| T |
52026537 |
tcgatcaattcattacaaatatgcttgcttttca |
52026570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University