View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20673_low_15 (Length: 236)
Name: NF20673_low_15
Description: NF20673
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20673_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 44815025 - 44814819
Alignment:
| Q |
13 |
gaagaaggttgaaaaaccgcctnnnnnnnctctgttattatttgttgcgcttttcgtttatttactcccctgcattccctagaatcagannnnnnnnaat |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44815025 |
gaagaaggttgaaaaaccgcctaaaaaaactctgttattatttgttgcgcttttcgtttatttactcccctgcattccctagaatcactttttttttaat |
44814926 |
T |
|
| Q |
113 |
aggattggtctgcattttgaagtttaaactgcttcctggttttatatttgcaatatttttgtaacctacagaattaacaagcttaaagacaaggaacgaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44814925 |
aggattggtctgcattttgaagtttaaactgcttcctggttttatatttgcaatatttttgtaacctacagaattaacaagcttgaagacaaggaacgaa |
44814826 |
T |
|
| Q |
213 |
atggctg |
219 |
Q |
| |
|
||||||| |
|
|
| T |
44814825 |
atggctg |
44814819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University