View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20674_high_21 (Length: 266)
Name: NF20674_high_21
Description: NF20674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20674_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 44006078 - 44006310
Alignment:
| Q |
18 |
aattattactgtgttagctcagctgctgctgttatttttcttgttgtttctctcttttgtattcccttttgcgtgctcttgctcatcttgtgctcaaagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006078 |
aattattactgtgttagctcagctgctgctgttatttttcttgt---ttctctcttttgtattcccttttgcgtgctcttgctcatcttgtgctcaaagc |
44006174 |
T |
|
| Q |
118 |
ttcctgtgattaataaattttgctaattcnnnnnnnnnnnnntgtctatagtaatcggatgtttttctttgnnnnnnnctacaaccaaatgttattatga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44006175 |
ttcctgtgattaataaattttgctaattc-aaaaaaaaaatatgtctatagtaatcggatgtttttctttgaaaaaaactacaaccaaatgttattatga |
44006273 |
T |
|
| Q |
218 |
aagtgatcaattgtcctgtctaaagtaacatgatgat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44006274 |
aagtgatcaattgtcctgtctaaagtaacatgatgat |
44006310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University