View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20674_high_26 (Length: 250)
Name: NF20674_high_26
Description: NF20674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20674_high_26 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 28739759 - 28739993
Alignment:
| Q |
16 |
attgaaatgaaatcaacaatgctaataattccaattcaactattaatccaaaataaattacctaacattggaattcatgatttgcaacgtatgagtcaga |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28739759 |
attgaaatgaactcaacaatgctaataattccaattcaactattaatccaaaataaattacctaacattggaattcatgatttgcaacgtatgagtcaga |
28739858 |
T |
 |
| Q |
116 |
aaaagatatcataaagtgaaacaattttcatgcatgttcaaatctggatctggaattataagcaaagttcaggtgcattcccaagatatggctattcaaa |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28739859 |
aaaggatatcataaagtgaaacaattttcatgcatgttcaaatctggatctggaattataagcaaagttcaggtgcattcccaagatatggctattcaaa |
28739958 |
T |
 |
| Q |
216 |
taatgccaagggtcttgtcagcctttgatgttgat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
28739959 |
taatgccaagggtcttgtcagcctttgatgttgat |
28739993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University