View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20674_high_33 (Length: 235)
Name: NF20674_high_33
Description: NF20674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20674_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 72 - 221
Target Start/End: Complemental strand, 8154890 - 8154741
Alignment:
| Q |
72 |
aatattgttcttaattccttttacttcctttgtttttgaattgatccttggttagaacttcttggttcatttcttctttctaattggataatttatatat |
171 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8154890 |
aatattgttcttaattccttttatttcctttgttcttgaattgatccttggttagaacttcttggttcatttcttctttctaaatggataatttatatac |
8154791 |
T |
|
| Q |
172 |
aatttacttgagtccttcaacgagagattggaaatggaaaatgattggta |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8154790 |
aatttacttgagtccttcaatgagagattggaaatggaaaatgattggta |
8154741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 8155355 - 8155289
Alignment:
| Q |
1 |
ctatgtgtctcgagcatatagaagactgaagagcatgaatcctccatggctcatgcaccctgcattt |
67 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8155355 |
ctatgtgtctcgagcatatggaagactgaagagcatgaatcttccatggctcatgcaccctgcattt |
8155289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University