View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20674_low_28 (Length: 247)
Name: NF20674_low_28
Description: NF20674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20674_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 29298091 - 29297854
Alignment:
| Q |
1 |
catagtaaaagaagtaagtcaaagcaattttctctactttgcttaaatatggatttgtattaattagtatattttcttatagattttatctggacctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29298091 |
catagtaaaagaagtaagtcaaagcaattttctctactttgcttaaatatggatttgtattaattagtatattttcttatagattttatctggacctgac |
29297992 |
T |
|
| Q |
101 |
cgtttgggaactgaggaagctattaatcagatgattgatttcatagatcaacatggtgggatggaaattgaattaggagattaaagttttttcagtgcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29297991 |
cgtttgggaactgaggaagctattaatcagatgattgatttcatagatcaacatggtgggatggaaattgaattaggagattaaagttttttcagtgcat |
29297892 |
T |
|
| Q |
201 |
caagctctaatttttaggcttcaatttctctgtagaat |
238 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29297891 |
caagctctaatttttaggcttgaatttctctgtagaat |
29297854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 69 - 167
Target Start/End: Complemental strand, 29316282 - 29316184
Alignment:
| Q |
69 |
atattttcttatagattttatctggacctgaccgtttgggaactgaggaagctattaatcagatgattgatttcatagatcaacatggtgggatggaaa |
167 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||||| |||||||||||||||||||||| ||| |||||||||||||||| ||| ||||||| |
|
|
| T |
29316282 |
atattttcttatagattttatctgaacctaaccgcctgggaagtgaggaagctattaatcagatgtctgacttcatagatcaacatgatggaatggaaa |
29316184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 68 - 170
Target Start/End: Complemental strand, 29326654 - 29326551
Alignment:
| Q |
68 |
tatattttctt-atagattttatctggacctgaccgtttgggaactgaggaagctattaatcagatgattgatttcatagatcaacatggtgggatggaa |
166 |
Q |
| |
|
||||||||||| ||||||||||||||||| | |||| ||||||||||||||||||||||||||||||| || ||||||| |||||||| || |||||| |
|
|
| T |
29326654 |
tatattttctttatagattttatctggacataaccgcctgggaactgaggaagctattaatcagatgatggacttcatagttcaacatgagggaatggaa |
29326555 |
T |
|
| Q |
167 |
attg |
170 |
Q |
| |
|
|||| |
|
|
| T |
29326554 |
attg |
29326551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 83 - 170
Target Start/End: Original strand, 42285777 - 42285864
Alignment:
| Q |
83 |
attttatctggacctgaccgtttgggaactgaggaagctattaatcagatgattgatttcatagatcaacatggtgggatggaaattg |
170 |
Q |
| |
|
|||||||| |||| | |||| |||| ||||||||||||| ||||||||||||||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
42285777 |
attttatccggacataaccgcctggggactgaggaagctactaatcagatgattgacttcatagatcaacatgatggaatggaaattg |
42285864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University