View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20674_low_29 (Length: 244)
Name: NF20674_low_29
Description: NF20674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20674_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 3651987 - 3652203
Alignment:
| Q |
10 |
ggaccacataacaagagatagctacccacttctagcccaaacaaaaggcatagcttatattttagagaaacttcatatagaaacacagctgattcttgct |
109 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3651987 |
ggaccacataacaagagatggctagccacttctagccaaaacaaaaagcataccttatattttagagaaacttcatatagaaacacagctgattcttgct |
3652086 |
T |
 |
| Q |
110 |
ggaaataattgaattgaggtgtatatatattaacctaaacatgtggtcgaagagtagtagggtacaaataaaacctttttattatttattatgaaaagga |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3652087 |
ggaaataattgaattgaggtg--tatatattaacctaaacatgtggtccaagagtagtagggtacaaataaaacctttttattatttattatgaaaagga |
3652184 |
T |
 |
| Q |
210 |
aataccataacaacatttg |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
3652185 |
aataccataacaacatttg |
3652203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University