View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20674_low_33 (Length: 236)
Name: NF20674_low_33
Description: NF20674
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20674_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 54263701 - 54263922
Alignment:
| Q |
1 |
tgcaggtgattagaaaaattgatgcatttgtctattacagaatttaattttgtgcaggtggggccgttgtttggattggttctgtgttagcttagccgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54263701 |
tgcaggtgattagaaaaattgatgcatttgtctattacagaatttaattttgtgcaggtggggctgttgtttggattggttctgtgttagcttagccgga |
54263800 |
T |
|
| Q |
101 |
aatagctatggtacagggggtgtttgattgggttgtgttggggagtcctcaatattatgtggttatctcaggatggggaggggtttcaagtgtctattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54263801 |
aatagctatggtacagggggtgtttgattgggttgtgtcggggagtcctcaatattatgtggttatctcaggatggggaggggtttcaagtgtctattgg |
54263900 |
T |
|
| Q |
201 |
atgttgagaggaggcatttggt |
222 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
54263901 |
atgttgagaggaggcatctggt |
54263922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University