View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_high_13 (Length: 367)
Name: NF20675_high_13
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 10 - 348
Target Start/End: Complemental strand, 5017746 - 5017408
Alignment:
| Q |
10 |
ataatactaaaaatgagttttaaaagtttatacaaaatgatatatcaatcagtatagatcattatgttcaatcctggatatcccagtaaggacaagtcat |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5017746 |
ataatactaaaaatgagttttaagagtttatacaaaatgatatatcaatcagtatagatcattatgttcaatcctggaaatcccagtaaggacaagtcat |
5017647 |
T |
 |
| Q |
110 |
ctgaagagaaaaagttgcatacaaacctggaaatccaggaaatgtgtatccagcatggtagaacatattaggaactaagttatgtgttgctgtggtagta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017646 |
ctgaagagaaaaagttgcatacaaacctggaaatccgggaaatgtgtatccagcatggtagaacatattaggaactaagttatgtgttgctgtggtagta |
5017547 |
T |
 |
| Q |
210 |
gcttccgatgcaacaggaaatgcttgccagccattaccattgaatgtctgaaaaatgggagggatggttgctccgaacagctgagtcggctgaaatacct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5017546 |
gcttccgatgcaacaggaaatgcttgccagccattaccattgaatgtctgaaaaatgggagggatgtttgctccgaacagctgagtcggctgaaatacct |
5017447 |
T |
 |
| Q |
310 |
gagccccttgttgaggatatggtaactgctgctgccatg |
348 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5017446 |
gcgccccttgttgaggatatggtaactgctgctgccatg |
5017408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 231 - 283
Target Start/End: Complemental strand, 5005605 - 5005553
Alignment:
| Q |
231 |
gcttgccagccattaccattgaatgtctgaaaaatgggagggatggttgctcc |
283 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5005605 |
gcttgccagccattaacattgaatgtctgaaaaatgggagggatatttgctcc |
5005553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 103 - 150
Target Start/End: Complemental strand, 5005661 - 5005614
Alignment:
| Q |
103 |
aagtcatctgaagagaaaaagttgcatacaaacctggaaatccaggaa |
150 |
Q |
| |
|
||||||| ||||||||||||||| |||||| ||||||||| ||||||| |
|
|
| T |
5005661 |
aagtcatatgaagagaaaaagttccatacatacctggaaagccaggaa |
5005614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University