View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_high_26 (Length: 284)
Name: NF20675_high_26
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 266
Target Start/End: Complemental strand, 1455138 - 1454880
Alignment:
| Q |
8 |
atattttggctaaagaagtggttggtcgatgggaatacgagtcttacatggcttggtggaatcgtgactttaaataaaggcgattggatttgatgttgtc |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1455138 |
atattttgcctaaagaagtggttggtcgatgggaatacgagtcttacatggcttggtggaatcgtgactttaaataaaggcgattggatttgatgttgtc |
1455039 |
T |
|
| Q |
108 |
agcaactccatgcgtttacactgtcaacgcgttagtgttggattgagatcgggtggtctagatttcaagttttataatgatctactatttatatgtttag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1455038 |
agcaactccatgcgtttacactgtcaacacattagtgttggattgagatcgggtggtctagatttcaagttttataatgatctactatttatatgtttag |
1454939 |
T |
|
| Q |
208 |
gnnnnnnnaacgttgatatgcaaattctgtctattaggttttagttttatgtttctatg |
266 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1454938 |
gtttttttaacgttgatatgcaaattctgtctattaggttttagtttgatgtttctatg |
1454880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 162 - 265
Target Start/End: Complemental strand, 1453699 - 1453593
Alignment:
| Q |
162 |
ggtctagatttcaagttttataatgatctactatttatatgtttaggnnnnnnnaacgttgatatgcaaattctgtctat----taggttttagttttat |
257 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| | |||| |||| ||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
1453699 |
ggtctagatttcgagttttataatgatctactatttatatatatagg-ttttataacgatgatatgcaaattctgtctcttagctaggttttaattttat |
1453601 |
T |
|
| Q |
258 |
gtttctat |
265 |
Q |
| |
|
|||||||| |
|
|
| T |
1453600 |
gtttctat |
1453593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 10 - 69
Target Start/End: Complemental strand, 1451417 - 1451358
Alignment:
| Q |
10 |
attttggctaaagaagtggttggtcgatgggaatacgagtcttacatggcttggtggaat |
69 |
Q |
| |
|
|||||| | |||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1451417 |
attttgccgaaagaagttattggtcgatgggaatacgagtcttacattgcttggtggaat |
1451358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University