View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_high_30 (Length: 258)
Name: NF20675_high_30
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 69 - 253
Target Start/End: Complemental strand, 24850276 - 24850092
Alignment:
| Q |
69 |
aagtttggaggttggatattagtcaagttaccaatcgaataaaataccactccagaatcagctgtgtttctactaatttttgaattttgacaaataaatt |
168 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850276 |
aagtttggaggttggacattagtcaagttaccaatcgaataaaataccactccagaatcagctgtgtttctactaatttttgaattttgacaaataaatt |
24850177 |
T |
 |
| Q |
169 |
tacttagatcagttactatgttgtatcagatcaaggtagcatgnnnnnnnagaggatctgcaaggtagcatgttcctttgcttct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
24850176 |
tacttagatcagttactatgttgtatcagatcaaggtagcatgtttttttagaggatctgcaaggtagcatgttcctttggttct |
24850092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University