View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_high_31 (Length: 257)
Name: NF20675_high_31
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_high_31 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 144 - 257
Target Start/End: Original strand, 31138045 - 31138158
Alignment:
| Q |
144 |
ccatatgatttataattgcagtcttttggtttccatgtaatttcttcagggtgtgattggtaacaacattactacagcatataagttgataactggaatg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31138045 |
ccatatgatttataattgcagtcttttggtttccatgtaatttcttcagggtgtgattggtaacaacattactacagcatataagttgataactggaatg |
31138144 |
T |
|
| Q |
244 |
caaaatttgaggaa |
257 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31138145 |
caaaatttgaggaa |
31138158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 101
Target Start/End: Original strand, 31137919 - 31138002
Alignment:
| Q |
18 |
cagagaacatttgaagatggaaaagcattatttgaaagtataatgatcatgatttacaacatgtttgacttattacacttgaag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31137919 |
cagagaacatttgaagatggaaaagcattatttgaaagtataatgatcatgatttacaacatgtttgacttattacaattgaag |
31138002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University