View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_high_39 (Length: 246)
Name: NF20675_high_39
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 125 - 232
Target Start/End: Original strand, 46090558 - 46090665
Alignment:
| Q |
125 |
ccttatgtccctattggcttaatgattcaactcatttcccacaattgaagtgcttcttgaactactgcatattaaaaagtatgatgctactattgtgggt |
224 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46090558 |
ccttatgtccctattgacttaatgattcaactcatttcccacaattgaagtgcttcttgaactactgcatattaaaaagtatgatgctactattgtgggt |
46090657 |
T |
 |
| Q |
225 |
tgtatttg |
232 |
Q |
| |
|
|||||||| |
|
|
| T |
46090658 |
tgtatttg |
46090665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 46090434 - 46090491
Alignment:
| Q |
1 |
caatcgttttgattagtgatatgaaatggatgttaatgcaaatcatgattgtgttcac |
58 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46090434 |
caatccttttgattagtgatatgaaatggatgttaatgcaaatcatgattgtgttcac |
46090491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University