View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20675_high_45 (Length: 201)
Name: NF20675_high_45
Description: NF20675
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20675_high_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 31060241 - 31060408
Alignment:
| Q |
20 |
attttttgtggctaaccctctagttccaaggtgacgagtgtgttagtaattcggagttcgatcagaagataagtaaaatctaaccttaaattgcttcgct |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31060241 |
attttttgtggctaaccctctagttccaaggtgacgagtgtcttagtaattcggagttcaattagaagataagtaaaatctaaccttaaattgcttcgct |
31060340 |
T |
|
| Q |
120 |
cataaatcaaacttgagttctctcgaacgattcgtcctaacggctcattaaccactttacagtataat |
187 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
31060341 |
cataaatcaaacttcagttctctcgaacgattcgtcctaacggctcattaaccactttccaatataat |
31060408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University